To answer the following questions, refer to this template DNA sequence: ATACCGTTATTTAACCGCCAGAAT What is the sequence of the non-coding (non-template) DNA strand? What is the mRNA sequence...

To answer the following questions, refer to this template DNA sequence:

ATACCGTTATTTAACCGCCAGAAT

What is the sequence of the non-coding (non-template) DNA strand?

What is the mRNA sequence (transcription)?

Expert Answers
ncchemist eNotes educator| Certified Educator

You are only allowed to ask one question so I have edited down.  The first two questions are very closely linked so I have left them as shown.

When given a template sequence of DNA that is to be read for protein coding (transcription), we know that the strand is naturally found as part of a double helix.  That means that there is a complementary sequence to the template sequence found in the DNA.  In DNA, G binds to C and A binds to T (and vice versa).  So the sequence of the non-coding strand would be: TATGGCAATAAATTGGCGGTCTTA.

When transcription takes place, the strand of DNA is read by RNA polymerase and a complementary strand of mRNA is created.  The difference here is that with RNA, T is replaced by U.  So the sequence of mRNA created would be: UAUGGCAAUAAAUUGGCGGUCUUA.

ayl0124 | Student

ATACCGTTATTTAACCGCCAGAAT

When dealing with DNA, the four bases you need to know are A & T and G & C. A pairs with T, and G pairs with C. Go through each base in the template strand and pair it with its corresponding base. For example, the first A would pair with a T and so forth. 

TATGGCAATAAATTGGCGGTCTTA

RNA is a little different than DNA. While DNA's four bases were ATGC, RNA swaps T for U. Therefore, A pairs with U, and G pairs with C. 

UAUGGCAAUAAAUUGGCGGUCUUA