To answer the following questions, refer to this template DNA sequence: ATACCGTTATTTAACCGCCAGAAT What is the sequence of the non-coding (non-template) DNA strand? What is the mRNA sequence (transcription)?

Expert Answers

An illustration of the letter 'A' in a speech bubbles

You are only allowed to ask one question so I have edited down.  The first two questions are very closely linked so I have left them as shown.

When given a template sequence of DNA that is to be read for protein coding (transcription), we know that the strand is naturally found as part of a double helix.  That means that there is a complementary sequence to the template sequence found in the DNA.  In DNA, G binds to C and A binds to T (and vice versa).  So the sequence of the non-coding strand would be: TATGGCAATAAATTGGCGGTCTTA.

When transcription takes place, the strand of DNA is read by RNA polymerase and a complementary strand of mRNA is created.  The difference here is that with RNA, T is replaced by U.  So the sequence of mRNA created would be: UAUGGCAAUAAAUUGGCGGUCUUA.

Approved by eNotes Editorial Team

We’ll help your grades soar

Start your 48-hour free trial and unlock all the summaries, Q&A, and analyses you need to get better grades now.

  • 30,000+ book summaries
  • 20% study tools discount
  • Ad-free content
  • PDF downloads
  • 300,000+ answers
  • 5-star customer support
Start your 48-Hour Free Trial